VARIFI - Web-based Automatic Variant Identification, Filtering and Annotation of Amplicon Sequencing Data

Fast and affordable benchtop sequencers (e.g. PGM from Ion Torrent) are becoming more important in improving personalized medical treatment. Still, distinguishing genetic variants between healthy and diseased individuals from sequencing errors remains a challenge

Here we present VARIFI, a pipeline for finding reliable genetic variants (SNPs and INDELs). We optimized parameters in VARIFI by analyzing more than 170 amplicon sequenced cancer samples produced on the PGM. In contrast to existing pipelines, VARIFI combines different analysis methods and, based on their concordance, assigns a confidence score to every identified variant. Furthermore, VARIFI applies variant filters for biases associated with the sequencing technologies (e.g. incorrectly called homopolymer-associated indels with Ion Torrent). VARIFI automatically extracts variant information from publicly available databases and incorporates methods for variant effect prediction.

VARIFI requires only little computational experience and no in-house compute power since the analyses are done on our server. Please read TUTORIAL for the instructions on how to use VARIFI and interpret its results.

Submit job

Email
Bed file
Browse

Upload the regions of interest in valid bed format (review bed format here).

1	3837	4076	JUNC00000001	9	+	3837	4076	255,0,0	2	76,81	0,158
1	4181	4584	JUNC00000002	19	+	4181	4584	255,0,0	2	95,99	0,304
1	4513	4790	JUNC00000003	7	+	4513	4790	255,0,0	2	92,85	0,192
1	5003	5271	JUNC00000004	15	+	5003	5271	255,0,0	2	92,98	0,170
Read file
Browse

Upload the amplicon sequencing data in fastq or bam format. Make sure that the read file does not exceed 400Mb.

@SEQ_ID
GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT
+
!''*((((***+))%%%++)(%%%%).1***-+*''))**55CCF>>>>>>CCCCCCC65

Processing...

0%